Skip to main content

Table 5 PCR primers for events for which a transcript sequence was available in the public databases

From: Genome-wide Profiling of RNA splicing in prostate tumor from RNA-seq data using virtual microarrays

Sl. no SpliceJunctionID_GeneName Amplicon Forward primer Reverse primer
1 JHS32215053_TARP 119 TCCCGGAACAAAGCTTATCA AAGACCAGGGTTCCAGTCCT
2 JHS31939933_SH3RF1 113 AGTTCCCATCGCTCCACCT GAGGAGGATAGGAAACCACCA
3 JHS31912679_PPP3CA 106 GTGTGTGCATGGTGGTTTGT CAGGATATCACACATAGGTCCA
4 JHS31958799_march6 108 GGGAAAGAATGCTAGGACTTGA GGTAAGGGCAAAATGCAAAA
5 JHS31704238_ARFGAP3 121 GGGCAAGCATAACCTATGGA TGAAACCATGACCAGTTGGA
6 JHS30608278_TAOK3 132 AAAGCATGTCATGGAACTTCG TCCAACTGGTGATTCTTGAGTG
7 JHS30807650_EIF2AK4 103 TGAAATTCTGGCTGTGGATCT CAGCTGCTTCACAGTTGTGTT
8 JHS30813189_TMEM87A 114 TGGCATTTCATCCTCAAAGG AAGGGATAGTCTTCAAGTGTGAGG
9 JHS31115850_TOM1L1 117 CAGAAGCAGAGGCTGAAACA CAGTCGAGTTCTTTGGAGCA
10 JHS32114870_RPL7L1 148 CGGAGCAAGAGCAAAGAAAA CGCTTAAACCTGAGCCCTTT
11 JHS31615632_TTC3 110 GCTGAACGGTTTAGATCCTCA CAGGCTGTCCTATTCCAAGG
12 JHS31498135_SF3B1 116 AGCATAGGCGGACCATGATA TTGTTCTCGCATTACATCCA
13 JHS31332823_KLK3 146 ACAGCTGAGCCACTCTGAGG CAGGGGTCGGGGAGATATAG
14 JHS30347840_CTBP2 106 TCCCTTAAAAAGACGGACAGC AGGGGAACTTGCAGGAGTCT
15 JHS31820386_SR140 100 GCCAGAGTTTTCAGGAGCAA TCTTTCTTGTCTCTTTCTCGTTCTC
16 JHS30945721_GTF3C1 123 GGTGCTTCAGAACCTGATCC AAGGCCTTCACAAGAACGTG
17 JHS30838314_C15orf44 131 GCCTGCAGACAGATGTACAGA TTTCAGCAGGTCCAGGAAAC
18 JHS31803136_CCDC14 125 TCTCAGGCAACTCCTCATTCT GCAAACTGACTGTTGCCATC
19 JHS32473823_KIAA0368 107 GGAGAGACAGTGGTATTTCAAGG GGCTGGCTAAGATCACTTGC
20 JHS30556221_"COPZ1,MIR148B" 107 GACGACACCTACCCCAGTGT ACTGTCAGGCCTTCCAAGAG
21 JHS31292790_"ECH1,HNRNPL" 104 AGAATGGAGTTCAGGCGATG CAGAGTGCAACAGCCAGAATA
22 JHS32163374_BCLAF1 107 CCAAGTACCCTGAGGAAGCA CGAAGGTCAGCAGAGTCACA
23 JHS31612151_SON 126 GGGAACTTCTCTGCTGCAAT ATCAGGGCCACTATCATGGA
24 JHS30594323_HSP90B1 118 GTCAAGGGTGTGGTGGACTC TCATGTCCAGCGTTTTACGA
25 JHS31048200_TTC19 103 ATTTTGCATGACGCTCTTCG GCTGACCCCGTATAAATGCT
26 JHS30077792_TSPAN1 103 CAAGTGTGGAACACCACCAT GGGGAAAGGCACTGTTCTCT
27 JHS30255522_NET1 101 CCCGAGGTGAACAGGATTTA TGTGAGTTCCTCTTCTGACATGA
28 JHS31707588_ATXN10 130 ATTGTTTGGGTGCATGCTTT CCTCCAGTTCTTTCATTCTTTCA
29 JHS31151584_CANT1 116 TGCTGTGGAAAGACTTCACG ATCCGGAGGGAGTGCATAG
30 JHS30592849_CCDC53 112 TGAGGAGAAACTGGCAGACC TTCAACTGTGACATCATCTAGGC
31 JHS31375495_HADHA 115 TGGACATGATGCTGACTGGT GTCCGTTCCTCTGGAGGTTT
32 JHS30830235_SLTM 113 TCTGCAGAAGAAAACAAGAGAGC TCATCTTCACCTTCTTGAGCTTC
33 JHS31129340_DDX5 124 GCCCGAAGCCAGTTCTAAAT CTTAGAGCAACTGGCCATCC
34 JHS30485155_HSPA8 109 AGTAGCAATGAACCCCACCA CACCATAAAGGGCCAATGTT
35 JHS30035592_PINK1 123 CGGAAACGGCTGTCTGAT AGCCCGAAGATTTCATAGGC
36 JHS31111518_ITGA3 117 CTGCACACAAGGGACCTTCA GCTAAGCGAGGTCTGGAGTG
37 JHS32407856_HEATR7A 112 GTCAGCATTGGGAAACGACT TCTCGCAGGAACATCAACAG
38 JHS30295263_AIFM2 123 AAGATCAACAGCTCCGCCTA ACAGTCACCAATGGCGTAGA
39 JHS32488635_DPM2 134 TACTACACCGCCTGGGTGAT AGTCCCACAAACAGGAGCAG
40 JHS31214980_CNN2 116 AGATGGGCACGAACAAGTG CAGGGACATGGAGGAGTTGT
41 JHS31314031_"EML2,MIR330" 118 GAATGGGCCACAGCTACTTG AAGCCAGCAACTTCCCATC
42 JHS31324130_RUVBL2 119 CCTGATCATGGCCACCAA TGTAGGGGGTGGTGGAGAC
43 JHS32401588_LYNX1 128 CTGATCCTGGTGGTCCTCAT GTGGTCATGCAGTAGGCAAC
44 JHS32407984_HEATR7A 136 TCAAGAGCAGCTGGGAGAAC TCCTTCAGCAGGATCTGGAG
45 JHS31597126_LAMA5 125 GGGAGTTCTCCACGTCAGTG CACGGTGTGGTTGCTCTG
46 JHS30447530_"ARAP1,STARD10" 104 TCAACCTCTGTGTTGTTATCTGC CCACACCTTCCTGTCCATCT
47 JHS30554360_MAP3K12 107 AGCACCCCAACATCATCACT AGCCCGCAGTACCTCATACA
48 JHS31372783_KLHL29 100 GTAGTGAGTGCAGGGGACAAC TCCAGTTATCAAGCAGGGACA
49 JHS30600491_ATP2A2 106 TGTCACTCCACTTCCTGATCC GGCAAGGAGATTTTCAGCAC
50 JHS32096926_"ATF6B,TNXB" 121 CTGGGCGCAAGTACAAGATG GTCATGGTAGGCACTGCTTG
51 JHS31749149_ALS2CL 111 ACCTTCACCAGGGACCTGAC CTGTGTGTGCAGTCCTCTCC