Skip to main content

Advertisement

Table 1 Gene-specific primers for TAIL-PCR

From: Development of detection method for novel fusion gene using GeneChip exon array

Primer name Sequence (5′-3′)
ABCC4-TAIL0 CTGGTGGTGGGCGTTTCTGATATTCCC
ABCC4-TAIL1 ACGATGGACTCCAGTCCGGCCTTTGTCGAACACAC CACTGAAACAT
ABCC4-TAI L2 CCAGGCGCTTCACATCTCTTGACGTTTCC
ATP6V0A4-TAIL0 TTCCATGTGCCGCTGAACATGGGTTGG
ATP6V0A4-TAIL1 ACGATGGACTCCAGTCCGGCCAAAGATGTTCAAGGACTTGGAGAAGCAG
ATP6VOA4-TAI2 CTGGG1TfATCTCCCGGTAGCTGCCGAC
CDCA2-TAIL0 GCATTGCAGTTTTCCTTCTGCAGCTCC
CDCA2-TAIL1 ACGATGGACTCCAGTCCGGCCTGCTGCAGGGTCAGAGCAGGTTTG
CDCA2-TAIL2 CTTGATG CATATGCAAATCTGGGTCATGACG C
CEP250-TAIL0 GAGCTGGGTCTGTAGTATCCCAGTGG
CEP250-TAIL1 ACGATGGACTCCAGTCCGGCCTCAGTCGTTCCAGTTGTTGGCTG
CEP250-TAIL2 AGCAGTGTCTCCAGGAGGGATACTCTC
MACF1-TAIL0 CGATCATCTAGGAGCCGCTGGAGC
MACF1-TAIL1 ACGATGGACTCCAGTCCGGCCAACCAGCTGAGCAATGGCTCC
MACF1-TAIL2 CCCACAATGCAACAAAGCTTCCTGTAGCTG
RLF-TAIL0 CCATTCCTTCAGTCTCTACAGGAGTCAC
RLF-TAIL1 ACGATGGACTCCAGTCCGGCCAAGGAAGGGGTGTGGAAAAACCCAG
RLF-TAIL2 CTGTCTCAACAGCCAGTAGAAACGGAGG
SLCO4A1-TAIL0 CAGGAGCCCCATGATGAGTATGTAG
SLCO4A1-TAIL1 ACGATGGACTCCAGTCCGGCCACAGCAGACAGGCCTTGTCGATC
SLCO4A1-TAIL2 GCATTTCCCTGCAGTGGCATGGCC