Skip to main content

Advertisement

Table 2 LAD primers and AC1 primer for TAIL-PCR

From: Development of detection method for novel fusion gene using GeneChip exon array

Primer name Sequence (5′—3′)
LDA1 ACGATGGACTCCAGAGCGGCCGC(G/C/A)N(G/C/A)NNNGGAA
LDA2 ACGATGGACTCCAGAGCGGCCGC(G/C/T/)N(G/C/T)NNNGGTT
LDA3 ACGATGGACTCCAGAGCGGCCGC(G/C/A)(G/C/A)N(G/C/A)NNNCCAA
LDA4 ACGATGGACTCCAGAGCGGCCGC(G/C/T)(G/A/T)N(G/C/T/)NNNCGGT
LDA5 ACGATGGACTCCAGAGAG(A/T)GNAG(A/T)ANCA(A/T)AGG
LDA6 ACGATGGACTCCAGAG(A/T)GTGNAG(A/T)ANCANAGA
AC1 ACGATGGACTCCAGAG