Skip to main content

Advertisement

Table 4 Primers for RT-PCR

From: Development of detection method for novel fusion gene using GeneChip exon array

Target fusion gene Primer name Orientation Sequence (5′- 3′) Amplicon size
DOCK5-CDCA2 DOCK5-exonl Forward GAGGAGCTGTAGCAGCCTTAGTCG 371 bp
  CDCA2-TAIL2 Reverse CTTGATGCATATGCAAATCTGGGTCATGACGC  
DOCK5-CDCA2 DOCK5-exon1 Forward GAGGAGCTGTAGCAGCCTTAGTCG 760 bp
  CDCA2-TAIL0 Reverse GCATTGCAGTTTTCCTTCTGCAGCTCC  
ZMYND8-CEP250 ZMYND8-exon18 Forward TACATCAGGAGGCMAGCGACA 513 bp
  CEP250-TAIL2 Reverse GCAGTGTCTCCAGGAGGGATACTCTC  
ZMYND8-CEP250 ZMYND8-exonl5 Forward GCCGCTTTTACCGAAGGAGACT 1476 bp
  CE P250-exon27 Reverse GCTGCTGCTCCGTGATATGAGA  
RLF-ZMPSTE24 RLF-TAIL2 Forward CCCCCAGGCTACTGCTTTATCAAAACTA 445 bp
  ZMPSTE24-exon3 Reverse CATAACCACAGAACCGTCCAGAAAG  
RLF-ZMPSTE24 RLF-exon1 Forward GTTGCCTACGCGCTGGTG 2167 bp
  ZMPSTE24-exon10 Reverse GATGTCCAGGATCTGTGACTGA